The prevalence of Carbapenem-resistance in Enterobacteriaceae is rising worldwide and poses a treatment challenge for healthcare facilities. This study aims to detect a sequence of New Delhi metallo-\(\beta\)-lactamase (NDM) and bla OXA-48 gene in metalo-beta-lactamase-producing Klebsiella pneumoniae isolated from a few hospitals in the city of Baghdad. 74 Klebsiella pneumoniae were isolated from 320 clinical samples that were routinely submitted to the diagnostic laboratory of the chosen hospital. These samples included sputum, tissue swabs, folly tips, urine, ear swabs, bloodstream, pus, wound swabs, endotracheal tubes, and body fluids. In this study, 74 isolates were examined for expression of carbapenemase by phenotyping method. The modified Hodge Test (MHT) is utilized for phenotypic detection. MHT was positive for 24 carbapenem-resistant Klebsiella pneumoniae. Genotyping was accomplished by using polymerase chain reaction (PCR) to amplify target genes by employing particular primers. The NDM gene was detected in 19/24 isolates, and the blaOXA-48 gene was detected in 5/24 isolates. The presence of bla NDM and the dangerously high frequency of MBL in the Klebsiella pneumoniae strain are both concerning, and it has been demonstrated to be challenging to treat and inhibit infection.
More and more reports of carbapenem-resistant Enterobacteriaceae are appearing worldwide, a significant problem for healthcare systems [1, 2]. MBLs can produce a wide variety of beta-lactamase activities, potentially negatively impacting many beta-lactam drugs, including carbapenems [3]. The plasmids that code for ESBLs can be transferred from one species to another, which presents a significant health risk, especially to those who have gotten to hospitals [4, 5]. Klebsiella pneumoniae is characterized by a polysaccharide capsule and is a rod-shaped, gram-negative, lactose-fermenting bacillus [6]. Potentially result in several infections, most frequently pneumonia, soft tissue, wound, and urinary tract infections [7]. Two main processes support K. pneumoniae resistance to carbapenems: i) synthesis of extended-spectrum-lactamases (also known as cephalosporins or ESBL) linked to porin depletion and ii) synthesis of carbapenem-hydrolyzing metallo-lactamases like class A carbapenemases, class B metals-beta-lactamase (VIM, NDM- or IMP-type) or class D carbapenemase OXA-48 [1, 2, 8, 9].
In 2009, NDM was initially discovered from a strain of Klebsiella pneumoniae that was highly contagious and resistant to many drugs [10]. Recent studies have led to the discovery of an NDM enzyme capable of conferring resistance to all \(\beta\)-lactams, in particular carbapenems [11]. In 2004, the OXA-48 carbapenemase was originally reported as being found in Turkish isolates [8]. OXA-48-producing bacteria commonly create several resistance mechanisms, some of which lead to multidrug resistance. These mechanisms include extended-spectrum-\(\beta\)-lactamases (ESBLs) and other resistance determinants.
Depending on the population’s age and the condition’s sickness profile, The percentage of deaths attributed to infections brought on by Klebsiella pneumoniae resistant to carbapenems could reach as high as 75% of the whole population [12]. According to the recommendations of the CLSI, carbapenemase-producing strains can be detected by utilizing several phenotypical approaches, such as the Modified Hodge Test (MHT)[13]. Following the recommendations provided by CLSI, The MHT was applied to identify carbapenemases-producing strains [10, 14]. The current work used NDM and bla OXA gene sequencing to discover metallo-\(\beta\)-lactamase-producing Klebsiella pneumonia.
Collection and Identification of Bacterial Strains
Three hundred twenty samples of sputum, tissue swab, folly tip, urine, ear swab, bloodstream, pus, wound swab, endotracheal tube, and body fluid were analyzed. A total of 74 K. pneumoniae were isolated from those samples by males and females from December 2022 to March 2023 from Iraqi patients in a few chosen hospitals in Baghdad city. The biochemical test, VITEK 2 compact system, was used to identify the isolated K. pneumoniae.
Carbapenemase Assay
Carbapenemase production investigated by a modified Hodge test was carried out [15]. After bringing a suspension of E. coli (sensitive strain) to a turbidity of 0.5 Mcfarland standard, it was injected equally on a Muller Hinton agar plate. After that, A disc containing (10) \(\mu\)g of meropenem was positioned precisely in the middle of the plate. The strains being tested were applied from the edge of the disc to the edge of the plate. The plate is allowed to incubate for 16-18 hours at \(35^{\circ}C\).
PCR Amplification and Sequencing
DNA extract from the bacterial isolates, the ABIOpureTM kit was utilized. A polymerase chain reaction (PCR) analysis using specific primers was carried out in order to look for carbapenemase genes in Klebsiella pneumoniae: blaNDM and blaOXA-48 (Table 1). The reaction was carried out using 20\(\mu\)l volumes containing 10\(\mu\)l GoTaq Green Master Mix (2X), 1\(\mu\)l for each primer (10pmol), 6\(\mu\)l nuclease-free water, and 2\(\mu\)l of template DNA. With the use of PCR Express, PCR cycling was carried out(Thermal et al., USA) utilizing the temperature program that is as follows: denatured at 94 degrees Celsius for four minutes, then subjected to thirty cycles of denaturation at 94 degrees Celsius for thirty seconds, annealing at 55, 58, 60, 63, or 65 degrees Celsius for thirty seconds, and extension at 72 degrees Celsius for thirty seconds. After a final extension incubation of seven minutes at 72 degrees Celsius, the reactions were stopped by an incubation lasting ten minutes at four degrees Celsius. Macrogen Corporation - Korea utilized an automated DNA sequencer known as the ABI3730XL to perform Sanger sequencing on the PCR results.
| Primer | Sequence (5'-3') | Anneal ing Temp. \(^{\circ}C\) |
Product size, bp | Reference | |
| OXA-48 | F | CCA AGCATT TTTACC CGCATC KACC | 55 | 338 | 16 |
| R | GYTTGACCATACGCTGRCTGCG | ||||
| NDM | F | GGTTTGGCGATCTGGTTTTC | 52 | 621 | 9 |
| R | CGGAATGGCTCATCACGATC | ||||
Bacterial Isolation
After laboratory identification using conventional morphological and biochemical tests as well as confirmation by VITECK, there were 74 isolates of Klebsiella pneumoniae. distributed urine (\(n=17\)), foly tip (\(n=5\)), sputum (\(n=18\)), blood (\(n=4\)), wound swab (\(n=6\)), body fluid (\(n=12\)), pus (\(n=5\)), ETT (\(n=2\)), tissue biopsy (\(n=3\)), ear swab (\(n=2\)). The rate among the strain of K. pneumoniae isolated from sputum and urine was higher than other isolates, while the lowest rate was observed among the strain isolated from ear swabs and end ETT. Isolates were found in individuals aged 1 to 60 years old, with 43.2% found in males and 56.7% in females.
Phenotyping Detection of Carbapenemase Producer
The 74 bacterial isolates were placed through screening tests to determine their carbapenemase production. The findings indicate that the MHT was positive for the presence of 24 Klebsiella pneumoniae strains resistant to carbapenem. A positive result for the MH test is characterized by a deformed inhibition zone, which appears like a clover leaf Figure 1.
PCR amplification
The ABIOpureTM kit made the DNA extraction for 24 carbapenemase-producing K. pneumoniae. The purity and concentration of DNA ranged from 21 -29 ng/\(\mu\)l. PCR analysis, which was then followed by sequencing, shows the presence of the NDM gene in in 19/24 isolated Figure 2 and The blaOXA-48 gene in 5/24 isolated Figure 3.