Original Article | | Volume 3 Issue 3 (July-September, 2013) | Pages 152 - 158

Molecular Epidemiology of CA-MRSA in a Healthy Community

 ,
1
Division of Microbiology, Department of Botany, Govt. M.V.M, Bhopal, India
Under a Creative Commons license
Open Access
Received
April 24, 2013
Accepted
June 18, 2013
Published
Sept. 30, 2013

Abstract

BACKGROUND: Community associated MRSA infection appears to be on the rise and has been described in several well-defined populations. The aim of the present study was to evaluate the epidemiology of CA-MRSA in the healthy community of Kashmir.

METHODS: Nasal swabs, wrist swabs and ocular specimens were collected randomly from the healthy subjects. The samples were processed on selective media and identification of the S.aureus was performed by using biochemical tests and by the amplification of nucA gene. Methicillin-resistance was confirmed by 30µg Cefoxitin disk diffusion method and by amplification of mecA gene. Pulsed field gel electrophoresis was used for the typing of CA-MRSA.

 RESULTS: Of 1000 healthy subjects that were screened in the present study, 100 (males 33, females 67) were positive for S.aureus. The highest prevalence of S.aureus (30%) was observed in the age group 50-59 years while the lowest 1% was reported in the age group 80-89 years. Of the 100 S. aureus colonization, 9 were MRSA and 91 were MSSA as determined by Cefoxitin 30µg disk diffusion test and PCR. DNA was extracted from all 9 CA-MRSA isolates and was used for amplification of mecA and nucA genes. A product size of 533bp was amplified for mecA gene and 275bp for nucA. PCR was performed for the amplification of PVL gene in all 100 isolates and only two were identified as PVL positive. The pulsed field gel electrophoresis results of CA-MRSA isolates were striking and expressed a similar banding pattern among all the isolates from the Kashmiri community.

 CONCLUSION: We found that the prevalence of CA-MRSA in the healthy population of Kashmir valley is quite high.

Keywords
PFGE; PCR; Pyoderma; Soft Tissue Infection; CA-MRSA

INTRODUCTION

Staphylococcus aureus is associated with serious skin and soft tissue infections in the community. A mortality rate of 20-25% still occurs with these pathogenic bacteria despite the use of appropriate antibiotics [1]. Various particular sites like nares, axillae, vagina and damaged skin surfaces are colonized with S.aureus. About 30-50% healthy people are colonized with this particular bacterium, with 10-20% persistently colonized [2]. Methicillin-resistant Staphylococcus aureus (MRSA) emerged as a widespread cause of hospital-associated infection in the late 1990’s [3]. Infections that are not acquired at a health care setting or institutions are considered community acquired methicillin resistant Staphylococcus aureus (CA-MRSA). According to the Centre for Disease Control and Prevention (CDC), the definition a CA-MRSA infection is community acquired when it is seen in an outpatient or within 48 hrs of hospitalization, when the patient lacks the following risk factors: receipt of hemodialysis, surgery, residence in long term care facility, or hospitalization during the previous year, and the presence of an indwelling catheter at the time of sample collection [5, 6]. These organisms have recently emerged as an important cause of community associated staphylococcal infections [4]. Molecular typing techniques have been widely used throughout the world for determining the evolutionary relationships of different clones and epidemiological studies of MRSA isolates [9]. MecA gene had been considered as a molecular marker for MRSA strains and is a useful tool for its identification. Polymerase chain reaction is a technique that enables the amplification of the specific sequences of a particular gene. Among different techniques, pulsed-field gel electrophoresis of SmaI had been considered as a standard for molecular typing [11]. PFGE had been suggested to be a useful tool for epidemiological investigations of various MRSA infections [12]. Many reports from India and Asia have highlighted the prevalence of MRSA in the community [13, 14, 15, 16]. MRSA, once considered primarily a nosocomial pathogen, is being increasingly reported from India   as a colonizer in healthy individuals without risk factors and a cause of community-acquired infections, including pyodermas [13, 14]. The implications of these reports for the current prescription practices for   cutaneous bacterial infections are obvious. It is therefore essential to determine the susceptibility pattern of clinical isolates of S. aureus in different communities across our diverse country. The present study was undertaken to determine the prevalence of MRSA in the Kashmiri community. In this study multiplex PCR and PFGE were used genotypically for the molecular typing of CA-MRSA isolates obtained from the healthy individuals of Kashmir Valley.

METHODS AND MATERIALS

Study population: From each of the 10 administrative districts of the Kashmir valley, two blocks were randomly selected and from each block two villages were chosen for sample collection to determine the prevalence of S.aureus, particularly MRSA. Before samples were collected, information about the study was explained to the community individuals after approval was sought from the head of each community. Oral consent for participation in the study was obtained. Detailed history was obtained and only those personnel were included in the study who had not taken any antibiotics seven days before the time of specimen collection. Questionnaires to obtain relevant information for the study were distributed to the community individuals. Ethical clearance for the study was obtained from the Institute Ethics Committee of Sher-i-Kashmir Institute of Medical Sciences Srinagar.

Samples and socio-demographic parameters: Samples from anterior nares, wrist swabs and ocular swabs were collected. Various important demographic factors like age, sex, occupation and antibiotic intake were recorded.

Specimen Collection and species identification:

  Nasal swab: Sterile cotton tipped swab was moistened in a culture tube containing 2 ml of 0.1% buffered Tween-80 (Hi-media). Swab was wrung out within the tube, swirled inside the anterior nares for five clockwise and five counter clockwise rotations, re-introduced into the culture tube, and wrung out [17].

Ocular swab: Cotton swabs moistened with brain heart infusion broth have been used to culture material from the conjunctiva and lid margins of both eyes [18]. The swabs were deposited in tubes containing 2 ml of detergent fluid (0.1% buffered Tween-80), 40 µl was then drop plated on to the 5% sheep blood agar and mannitol salt agar plate, incubated for 24 hrs at 35C and observed for the growth of suspected staphylococcal colonies. After the identification and confirmation of cultures, strains were preserved at -70C in freezer vials containing 15% glycerol for further analysis.

Hand swab: Sterile cotton tipped swab was moistened in a culture tube containing 2 ml of 0.1% buffered Tween-80 (Hi-media). Swab was wrung out within the tube and rotated 5 times on both sides of the wrists and then reintroduced in to the culture tube [19]. The staphylococcal isolates were identified morphologically and biochemically by standard laboratory procedures. The coagulase plasma test was performed on organisms exhibiting typical staphylococcal colony morphology to allow for discrimination of S.aureus from coagulase negative staphylococci. Resistance to methicillin was detected with the Cefoxitin (30μg) disk diffusion test [20] and interpreted as per [21]. DNA of S.aureus was extracted using as per Brakstad 1993 [22]. The detection of mecA and nuc genes was carried out  using multiplex PCR procedure [23]. DNA of S.aureus was extracted using as per Brakstad 1993 [22]. The detection of mecA and nuc genes was carried out using multiplex PCR procedure [23]. The following primer sequences of mecA gene 5 AAA ATC GAT GGT AAA GGT TGC C 3 and  3 AGT TCT GCA GTA CCG GAT TTG C 5 was responsible for methicillin resistance; nucA gene 5 GCG ATT GAT GGT GAT ACG GTT 3 and 3 AGC CAA GCC TTG ACG AAC TAA AGC 5  is responsible for the production of thermo-stable nuclease and was thus included in the multiplex PCR assay in order to confirm that the isolates are indeed S.aureus and not other Staphylococcal species, while the PVL gene 5 ACACACTATGGCAATAGTTATTT 3 and 3 AAAGCAATGCAATTGATGTA 5  encodes Panton Valentine Leukocidin toxin (PVL). A pore forming toxin was included in order to compare the CA-MRSA strains with hospital acquired methicillin resistant Staphylococcus aureus (HA-MRSA) strains. PCR protocol for PVL was performed [24]. DNA fingerprinting technique by pulsed field gel electrophoresis (PFGE) was used to determine and compare the PFGE patterns of MRSA strains of different sources as per  Matushek et al., [25] and performed in a contour clamped homogeneous electric field apparatus (CHEF DR III, Bio-Rad Laboratories, Hercules, California, USA). DNA fingerprints have been analyzed using the Quantity One software version 4.4.1 from Bio-Rad to construct a dendrogram of relationship among various isolates. DNA fragments on each gel were normalized using molecular weight markers to allow comparison between different gels and 1.5% band tolerance was selected for comparison of DNA profiles. Cluster analysis was performed by un-weighted paired group method with arithmetic averages (UPGMA), and DNA relatedness was calculated based on dice coefficients of similarity [26].

RESULTS

Of the 1000 healthy screened subjects, 100 (10%) were positive for S.aureus (33 males and 67 females). The highest prevalence (30%) of S.aureus was observed in the age group 50-59 years while the lowest 1% was reported in the age group 80-89 years (Table 1). The high prevalence of 44.4% MRSA was recorded in females in the age group of 40-49 years, and lowest 11.1% was observed in males in the age group of 1-9, 10-19, and 70-79 years respectively (Table 1). The main occupation of the healthy subjects was farming and participants were residents of the far-flung areas of the Kashmir Valley. Of the 100 S.aureus isolates, 49% and 30% were obtained from nasal samples and wrist swabs and 21% were from ocular sources of healthy subjects. Of these 100 isolates, 9% confirmed MRSA and 91% MSSA by Cefoxitin 30µg disk diffusion test. The maximum number of MRSA were isolated from nasal specimens (5), followed by soft tissue infection sites (4). No MRSA was isolated from the ocular sources. DNA was extracted from all nine CA-MRSA isolates and was used in multiplex PCR for the amplification of mecA, and nucA genes. All nine strains were amplified successfully for the respective genes. A product size of 533bp was amplified for mecA gene, and 275bp was amplified for nucA [Fig. 1]. PCR was performed for the amplification of PVL gene in all 100 isolates and only two isolates were identified as PVL positive and both of them were CA-MRSA assessed in pyodermal infectious persons residing in the community (these patients were enrolled because they were community-dwelling and apparently healthy). The identity of the PCR products was confirmed by running a 1000 bp ladder along the amplified products on 1.5% agarose and product size of 176 bp was amplified [Fig. 2]. Pulsed field gel electrophoresis (PFGE) was performed on all CA-MRSA isolates using SmaI as a restriction endonuclease. Cluster analysis was performed by using the unweighted pair group method based on Dice coefficients. Pulsed field type clusters were defined by using a similarity coefficient of at least 80%.

The PFGE results of CA-MRSA isolates were striking and expressed a similar banding pattern among all the isolates from the Kashmiri community. Two clusters (a and b) formed by all the genotypes represented 100% similarity within the groups [Fig. 3].

All the 9 isolates belong to a single clone prevailing in the community, meaning there had not been any clonal evolution among the MRSA isolates in the healthy population of Kashmir. Although the similar banding pattern was observed in all MRSA isolates, only 9 different antibiograms have been observed in the respective isolates.

DISCUSSION

Staphylococcus aureus is a leading cause of community acquired infections, particularly in humans colonized with it [27]. During the current investigation, (10%) S.aureus carriage rate was analyzed in healthy individuals, whereas, 10-40% colonization in normal healthy individuals had been reported [28]. Staphylococcus aureus colonizes asymptomatically, mainly in the anterior nares of humans. The present study showed an overall prevalence of 49% of S.aureus in the anterior nares of healthy subjects. Similar findings were analyzed from the nasal swabs of healthy subjects [30].  Total of 9% CA-MRSA prevalence was recorded in the current study whereas, 9.9% had been observed in normal adult population [32] although, a much lower rate of 0.2% was found in another study [33].  Genotypic tests like PCR are the preferred meth od for the detection of mecA gene and nucA gene 38]. The present investigation provided an evidence for the presence of mecA gene at 533bp and nucA gene at 275bp in all CA-MRSA isolates. Similar findings had been determined [39,40]. Only two CA-MRSA isolates have been found positive for PVL gene with a product size of 176bp [41]. However, a study detected PVL gene in only one CA-MRSA strain [42]. CA-MRSA had been described to carry the loci for PVL in high frequency and to be associated with the type IV (SCCmec) [43]. In order to track the original MRSA clone and the substitute clone, the previous histories, related with hospitalization of all the subjects, including those who were PVL positive, were reviewed. The following variables have been collected: patient demographics (gender and age); ward; underlying diseases; the length of time after  admission that a sample for culture was obtained; the presence of an invasive device (e.g., a vascular catheter or a gastric feeding tube) at the time of admission; and a history of MRSA infection or colonization, surgery, hospitalization,

dialysis, or residence in a long-term care facility in the 12 months preceding the culture. These two MRSA isolates have been noticed in the patients who were suffering from pyoderma as per their medical records, but lacks all risk factors, except of previous hospitalization before two months of sample collection and have been considered as carriers as per their medical records.  Currently there are numerous typing techniques for the discrimination of Staphylococcus aureus isolates, which can be applied as invaluable tools by both the clinician and the epidemiologist. The greatest challenge for a clinical laboratory is to carry out an analysis that can reliably group epidemiologically related strains and discriminate them from unrelated strains. Usually, these typing systems are used for the investigation of outbreaks of nosocomial infection, and furthermore can aid in the clinical treatment of a patient, allowing for discrimination between successive and recurrent infections, and in a broader context they contribute to the understanding of the epidemiology of infections [10]. During the current investigation two clusters (a & b) were formed by all the genotypes representing 100% similarity within the groups. 100% similarity was noticed between the 5 strains isolated from nasal samples and 4 from soft tissue infection sites of wrists. Similar results have been observed [44]. However an investigation reported 4 PFGE types among 132 MRSA isolates [45]. A single MRSA clone prevailing in the community means that there had not been any clonal evolution among the MRSA isolates in the Kashmiri community. It is also possible that no new MRSA strain had been introduced in to Kashmiri community or if they have introduced they might have not persisted. Low incidence of MRSA colonization in an adult outpatient population indicated that MRSA carriers most likely acquired the organism through contact with healthcare facilities rather than in the community. Thus it is clear that care must be taken when attributing MRSA colonization to the community if detected in outpatients or during the first 24 to 48 hrs of hospitalization.

CONCLUSION

In conclusion it was found that only a single CA- MRSA clone is roaming in healthy community of Kashmir that was detected by PFGE technique. Indiscriminate use of the antibiotics has given rise to a number of CA-MRSA clones throughout the world that have spread from one region to another through different routes. Both phenotypic and genotypic methods proved to be sensitive and specific for the detection of MRSA during the current investigation. Molecular typing by PFGE should be made an essential technique in epidemiological outbreaks and has proved to be a gold standard during the present study.

ACKNOWLEDGEMENTS

We are highly thankful to the Department of Medical Microbiology SKIMS Srinagar and RRL Jammu for providing the necessary lab facilities to perform this precious research.

REFERENCES

  1. Archer GL. Staphylococcus aureus a well armed pathogen. Clin Infec Dis 1998; 26:1179-1181.
  2. Noble WC, Valkenburg HA and Wolters CHL. Carriage of S. aureus in random samples of a normal population. J Hyg Lond 1967; 65:567-573.
  3. Prevost GB, Jaulhac and Piemont Y. DNA fingerprinting by pulsed field gel electrophoresis is more effective than ribotyping in distinguishing among methicillin resistant Staphylococcus aureus isolates. J Clin Microbiol 1992; 967-973.
  4. Beiger EM, Frenette K and Barrett NL. A high morbidity outbreak of methicillin resistant Staphylococcus aureus among players on a college football team facilitated by cosmetic body shaving and truf burns. Clin Infec Dis 2004; 39:1446-1453.
  5. Centers for Disease Control (CDC-2007). Severe methicillin resistant Staphylococcus aureus community acquired pneumonia associated with influenza Louisiana and Georgia, 2006-2007. (MMWR) Morb Mortal Wkly Rep 56:325-329.
  6. Morrison MA, Hageman JC and Klevens RM. Case definition community acquired methicillin resistant S.aureus. J Hosp Infect 2006; 62:241.
  7. Fridkin SK, Hageman JC and Morrison M. Methicillin resistant Staphylococcus aureus disease in three communities. N Engl J Med 2005; 352:1436-1344.
  8. David MZ, Glikman D, Crawford SE. What is community associated methicillin resistant Staphylococcus aureus. J Infect Dis 2008; 197:1235-1243.
  9. Oliveira DC, Tomasz A and De LH. The evolution of pandemic clones of methicillin resistant Staphylococcus aureus: identification of two ancestral genetic backgrounds and the associated mec elements. Microb Drug Resist 2001; 7:349-361
  10. Arbeit RD, Murray PM, Baron EJ, Pfaller MA, Tenover FC, Yolken RH (1999). Laboratory procedures for the epidemiologic analysis of microorganisms. Manual of clinical microbiology. 7th ed.ASM Press:Washington, D. C.1999; pp. 116-137.
  11. Schmitz FJ, Steiert M, Tichy HV, Hofmann B, Verhoef J, Heinz HP, et al. Typing of methicillin resistant Staphylococcus aureus isolates from Dusseldorf by

six genotypic methods. J Med Microbiol 1998; 47:341-351.

  1. Aucken HM, Ganner S, Murchan BD, Johnson AP. A new UK strain of epidemic methicillin resistant Staphylococcus aureus (EMRSA-17) resistant to multiple antibiotics. J Antimicrob Chemother 2002; 50:171-175.
  2. Saxena S, Singh K, Talwar V. Methicillin-resistant staphylococcus aureus prevalence in community in the east Delhi area. Jpn J Infect Dis 2003; 56:54-6.
  3. Nagaraju U, Bhat G, Kuruvila M, Pai GS, Jayalakshmi, Babu RP. Methicillin-resistant staphylococcus aureus in community-acquired pyoderma. Int J Dermatol 2004; 43:412-4.
  4. Tan HH, Tay YK, Goh CL. Bacterial skin infections at a tertiary dermatological centre. Singapore Med J 1998; 39:353-6.
  5. Nishijima S, Kurokawa I. Antimicrobial resistance of staphylococcus aureus isolated from skin infections. Int J Antimicrob Agents 2002; 19:241-3.
  6. Dar JA, Thokar MA, Khan JA, Ali A, Khan MA, Rizwan M, Bhat KH, Dar MJ, Ahmed N and Ahmad S. Molecular epidemiology of clinical and carrier strains of MRSA in the hospital settings in India. Annals of Clin Microbiol and Antimicrobials 2006; 5:1-15.
  7. Bashir G,Shah A,Thokar MARashid SShakeel S. Bacterial and fungal profile of corneal ulcers – a prospective study. Indian J Pathol Microbiol 2005; 48:273-7.
  8. Bauer AW, Kirby WMM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966; 45:493.
  9. Clinical and Laboratory Standards Institute (CLSI-2009). Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically approved standard: eighth edition. Wayne, PA.
  10. William J, Mason, Jon S, Blevins, Karen B, Noroyono W, et al. Extraction of DNA from bacterial cells. J Clin Microbiol 2001; 39:3332-3338.
  11. Brakstad OG, Maeland JA, Tveten Y. Multiplex polymerase chain reaction for detection of genes for Staphylococcus aureus thermo-nuclease and methicillin resistance and correlation with oxacillin resistance. Apmis 1993; 101:681-688.
  12. McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, Zhang K. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton Valentine leukocidin genes and simultaneous discrimination of methicillin susceptible from resistant staphylococci. J Clin Microbiol 2006; 44:1141-4.
  13. Matushek MG, Bonten MJ, Haydan MK. Rapid preparation of bacterial DNA for Pulsed filed gel electrophoresis. J Clin Microbiol 1996; 48-57.
  14. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH and Swaminathan B. Interpreting chromosomal DNA restriction Patterns produced by Pulsed Field Gel Electrophoresis: Criteria for Bacterial strain typing. J Clin Microbiol 1995; 33:2233-2239.
  15. Kuehnert MJ, Kruszon MD, Hill HA. Prevalence of Staphylococcus aureus nasal colonization in the United States, 2001–2002. J Infect Dis 2006; 193:172-179.
  16. Kloos WE, Collier I, Ballows LA and Sussman (1998). Staphylococcus: M(ed) Topley and Wilson’s Microbiology and Microbial infections. 9th edition, volume 2, Oxford University Press, New York. 577-632.
  17. Rajendra GN, Deepali A, Prasanth HN, Gaddad SM. Antibiotic sensitivity pattern of community associated methicillin resistant Staphylococcus aureus (CA-

MRSA) in High schools, Bangalore city, Karnataka, South India. IMJSR 2011; 1:27-35.

  1. Oyetunji IA, Ikenna OO, Olumide AO, Okwori AEJ. Prevalence of methicillin resistant Staphylococcus aureus from healthy community individuals volunteers in Jos South, Nigeria. Journal of Microbiology, Biotechnology and Food Sciences 2012; 1:1389-1405.
  2. Shiv SC, Pallab R, Arun A, Anindita D and Meera S. A community based study on nasal carriage of Staphylococcus aureus. Indian J Med Res 2009; 130:742-748.
  3. Goud R, Gupta S, Neoqi U, Agarwal D, Naidu K, Chalannavar R, Subhaschandra. Community prevalence of methicillin and vancomycin resistant Staphylococcus aureus in and around Bangalore, South India. Rev Soc Bras Med Trop 2011; 44:309-12.
  4. Nicole M, Broekema, Tam TV, Timothy A, Monson, Steven A, Marshall, David M. Comparison of cefoxitin and oxacillin disk diffusion methods for detection of mecA mediated resistance in Staphylococcus aureus in a large scale study. J Clin Microbiol 2009; 47:217-219.
  5. Rijal KR, Pahari N, Shrestha BK. Prevalence of methicillin resistant Staphylococcus aureus in school children of Pokhara. Nepal Med Coll J 2008; 10:192-195.
  6. Mendiratta PL, Vidhani S, Mathur MD. A study on Staphylococcus aureus strains submitted to a reference laboratory. Indian J Med Res 2001; 114:90-4.
  7. Saxena S, Singh K, Talwar V. Methicillin resistance Staphylococcus aureus prevalence in community in the east Delhi area. Jpn J Infect Dis 2003; 56:54-6.
  8. Nagaraju U, Bhat G, Kuruvila M, Pai GS, Jayalakshmi, Babu RP. Methicillin resistant Staphylococcus aureus in community acquired pyoderma. Int J Dermatol 2004; 43:412-4.
  9. Thean YT. A comparison of PCR detection of mecA with two standard methods of oxacillin disk susceptibility testing for coagulase negative staphylococci. J Med Microbiol 2002; 51:83-85.
  10. Murakami KW, Minamide KW, Nakamura E, Teraoka H and Watanabe S. Identification of methicillin resistant strains of Staphylococci by polymerase chain reaction. J Clin Micrbiol 1991; 29:2240-4.
  11. Szczepanik AM, Koziol-Montewka Z, Al-Doori D, Morrison and Kaczor D. Spread of a single multi resistant methicillin resistant Staphylococcus aureus clone carrying a variant of staphylococcal cassette chromosome mec type III isolated in a university hospital. European J Clin Microbiol Infect Dis 2007; 26:29-35.
  12. Ryan R, McDonald NA, Antonishyn TH, Laelie AS, Evelyn N, Michael RM, et al. Development of a triplex real time PCR assay for detection of Panton Valentine Leukocidin toxin genes in clinical isolates of methicillin resistant Staphylococcus aureus. J Clin Microbiol 2006; 6147-6149.
  13. Abeer G, Ola K, Samia E, Nancy, M, Shimaa ES. Detection of community acquired methicillin resistance among Staphylococcus aureus isolates. J Am Sci 2011; 7:423-431.
  14. Okuma KK, Iwakawa JD, Turnidge WB, Grubb JM, Bell FG, O’Brien GW, et al. Dissemination of new methicillin resistant Staphylococcus aureus clones in the community. J Clin Microbiol 2002; 40:4289-94.
  15. Mari M, Nakamura KL, Rohling MS, Hongzhou LU, Yi WT, Kathryn M. Prevalence of methicillin resistant Staphylococcus aureus nasal carriage in the community pediatric population. Pediatr Infect Dis J 2002; 21:917-21.
  16. Ulrich S, Ekaterina VK, James GJ, Sue JH, Yun FW, Mark DK, et al. Emergence of Community associated methicillin resistant Staphylococcus aureus USA300 genotype as a major cause of health care associated blood stream infections. Clin Infect Dis 2006; 42:647-56.
  17. Corbella X, Dominguez MA, Pujol M, Ayats J, Sendra M, Pallares R, et al. Staphylococcus aureus nasal carriage as a marker for subsequent infections in intensive care unit patients. Eur J Clin Microbiol Infect Dis 1997; 16:351-357.
Recommended Articles
Research Article In-Press

Popular Dietary Patterns and Human Health: Mediterranean, DASH, Vegan, Nordic, Planetary, Ornish, Ketogenic, Atkins, Paleo, Gluten-free, Low-FODMAP, Intermittent fasting, Macrobiotic, Alkaline and Other Contemporary Diets

...
pdf Download PDF
Research Article

Parental Satisfaction with Sustained Nursing Services in Pediatric Wards at Mosul Hospitals

Published: 05/09/2026
pdf Download PDF
Research Article

BMI as a Determinant of Menstrual Health: A Comparative Analysis Across Weight Categories

...
Published: 05/09/2026
pdf Download PDF
Research Article

Lymphoid and Myeloid Immune Cell Subsets Gene Markers and their Upregulation after Activation with Enterobacter Cloacae by using the Immune Cell Culture Technique

...
Published: 05/09/2026
pdf Download PDF
Copyright © Journal of Pioneering Medical Sciences until unless otherwise.