Research Article | | Volume 14 Issue 5 (May, 2025) | Pages 110 - 115

Molecular Identification of MexB Efflux Pump Gene in Clinical Isolates of Pseudomonas aeruginosa

 ,
1
Department of Biology, College of Education for Pure Sciences, Diyala University, Diyala, Iraq
Under a Creative Commons license
Open Access
Received
March 10, 2025
Revised
March 28, 2025
Accepted
April 14, 2025
Published
June 5, 2025

Abstract

Background: Pseudomonas aeruginosa is a significant nosocomial pathogen notorious for its multidrug resistance (MDR), often mediated by efflux pumps like MexAB-OprM. This study aimed to molecularly identify the mexB gene within clinical isolates of P. aeruginosa and assess its correlation with antibiotic resistance profiles. This study aims to detect the presence of the MexB efflux pump gene in clinical isolates of Pseudomonas aeruginosa and to investigate its association with antibiotic resistance patterns, particularly multidrug resistance, to better understand the molecular mechanisms underlying antimicrobial resistance and support effective therapeutic strategies. Methodology: All clinical isolates of P. aeruginosa from patients at Teaching Ba'aqubah Hospital and Teaching Albatool Hospital were investigated in this study. identified with the Vitek 2 compact, MexB efflux pump genes are detected by the PCR technique and primers are designed in the biology department of the College of Education of Pure Science in Iraq. Conventional PCR results showed that the gene, MexB, was present in all seven clinical isolates of P. aeruginosa. It was concluded that carrying efflux pump genes can make P. aeruginosa more resistant to several drugs. Result: From the 100 clinical specimens collected P. aeruginosa recorded a high percentage of isolated 67(67%), P. aeruginosa isolates Including; Chronic burns swab 23 (34.3%), Wounds swab 15 (22.4%), Urine from UTI patients 12 (17.9%), Sputum 10 (14.9%) and Ear swabs 7 (10.5%). All isolates were obtained by cultural characterisation These clinical isolates were on cetrimide agar, which is a selective medium for Pseudomonas spp.at 37°C for 24 hours. the VITEK2 compact System to confirm the diagnosis of Pseudomonas aeruginosa. Conclusion: According to our research, any P. aeruginosa that has the MexB gene of the efflux pump in the MexABOprM operon may enhance drug expulsion and antibiotic resistance, which could cause health issues for patients, particularly those with compromised immune systems.

Keywords
Mexab-Oprm operon, PCR, Pseudomonas aeruginosa, Efflux pump

INTRODUCTION

A formidable opportunistic pathogen that causes serious infections in clinical settings, Pseudomonas aeruginosa is a Gram-negative bacterium known for its adaptability and inherent resistance to a wide range of medications. One of the biggest obstacles to preventing and treating infections brought on by this microbe is its innate and acquired antibiotic resistance [1]. P. aeruginosa has been connected to several antibiotic resistance mechanisms, including the innate resistance-related development of bacterial efflux pumps, which transport substrates from the bacterial core to the cell surface [2,3].

 

Pseudomonas aeruginosa is a powerful opportunistic pathogen in clinical settings, causing increasing hospital-acquired Pseudomonas aeruginosa infections and its inherent resistance to several medications. This resistance is largely caused by the action of multidrug efflux pumps, particularly the MexAB-OprM system [4]. MexB is the inner membrane transporter in this tripartite complex, aggressively removing many antibiotics and harmful substances from the bacterial cell to reduce their intracellular concentrations and effectiveness. The defence of P. aeruginosa against several antibiotics, such as beta-lactams, fluoroquinolones and aminoglycosides, depends on the MexAB-OprM efflux pump. Treatment of infections brought on by this pathogen is made extremely difficult by the overexpression or mutations in the genes encoding this efflux mechanism, such as mexB, which have been connected to multidrug-resistant (MDR) phenotypes [5].

 

The defense of P. aeruginosa against several antibiotics, such as beta-lactams, fluoroquinolones and aminoglycosides, depends on the MexAB-OprM efflux pump. Treatment of infections brought on by this pathogen is made extremely difficult by the overexpression or mutations in the genes encoding this efflux mechanism, such as mexB, which have been connected to multidrug-resistant (MDR) phenotypes [6]. ​

 

In conclusion, the MexB efflux pump is an important variable in P. aeruginosa drug-resistant bacteria”. To effectively address antibiotic resistance in this adaptive pathogen, molecular investigations that concentrate on the identification and functional study of the mexB gene are crucial [7,8].

 

This study aims to detect the presence of the MexB efflux pump gene in clinical isolates of P. aeruginosa and to investigate its association with antibiotic resistance patterns, particularly multidrug resistance, to better understand the molecular mechanisms underlying antimicrobial resistance and support effective therapeutic strategies.

MATERIALS AND METHODS

Sample Collection

During the period from 4 January 2025 to 28 March 2025. 100 clinical specimens, including burn swabs, wound swabs, ear swabs, throat swabs, Urinary Tract Infection (UTI) infections, sputum and urethral swabs) were collected from patients’ attending (Teaching Ba'aqubah Hospital and Teaching Albatool Hospital in Diyala\Iraq). Bacterial isolates and identification. The identification of all bacterial isolates was conducted using morphological techniques, which involved the utilisation of culture media, including Cetrimide Agar and other media, as well as biochemical assays, including oxidase, catalase, TSI and indole [9,10].

 

VITEK2 compact system through Pseudomonas aeruginosa identification. The Vitek-2 compact system (BioMérieux in France) was used to confirm the diagnosis for every clinical isolate [11].

 

Genomic DNA Extraction commercial PrestoTM Mini gDNA Bacteria Kit (Geneaid, Taiwan) was used to extract the genomic DNA of P. aeruginosa isolates [12-14) Using the EasyTaq® PCR SuperMix kit (Trans Gen, China), a conventional PCR experiment was performed to amplify the MexB gene of P. aeruginosa, as indicated in Table 1. Lyophilized primers from Macrogen, Korea, were used to make the primer stock solution. Table 2 lists the exact primers for the MexB gene used in this investigation methods.

 

Molecular Assay

MexB gene Detection

All the selected isolates of P. aeruginosa were identified with the MexB gene. The positive gene result was subsequently confirmed through electrophoresis on a 1.5% agarose gel stained with ethidium bromide, electrophoresed at 75 volts for 50 minutes and visualized under an ultraviolet (UV) transilluminator. The present study revealed the presence of a sharp, singular and non-dispersed 180 bp MexB gene band, which was clearly distinguished from the DNA ladder, as demonstrated in Figure 1. Notably, there was no evidence of DNA degradation, as indicated by the absence of any smearing of the gene band.

 

Quantitation of DNA

The concentration of extracted DNA was measured using a Quantus Fluorometer to assess the quality of the samples for use in subsequent processes. QuantiFluor Dye was diluted and combined with 1 µL of DNA. DNA concentration readings were found after 5 minutes of room temperature incubation.

 

Primer Preparation

The Macrogen Company provided these primers in a lyophilized form. Nuclease-free water was used to dissolve lyophilized primers, resulting in a stock solution with a final concentration of 100 pmol/µL. To create a workable primer solution of 10 pmol/µL, 10µL of primer stock solution (which was kept at -20°C in the freezer) was mixed with 90 µL of nuclease-free water. The table illustrates the Reaction Setup process.

 

The PCR reaction tubes were mixed briefly and placed into a thermocycler PCR instrument where DNA was amplified according to the PCR program as indicated in Table 2-4. The optimum temperature for annealing primers, specifically for phzM is 60°C.

 

Agarose Gel Electrophoresis

Agarose gel electrophoresis verified the existence of amplification following PCR amplification. According to the extracted DNA criteria, PCR was reliable.

 

Table 1: Components of PCR reaction with their volume

Components

Volume

2×EasyTaq® PCR Super Mix volume (dNTPs, Taq polymerase, MgCl2 and PCR buffer)

12.5 µL

Forward Primer (10 pmol/µL)

1 µL

Reverse Primer (10 pmol/µL)

1 µL

Template DNA

3 µL

Nuclease-free water

7.5 µL

Total volume

25 µL

 

Table 2: MexBreverse, forward primers and their housekeeping genes

Primer name

Sequence 5`-3`

Annealing temperature (°C)

Product size (bp)

References

MexB-F

GTACCGGCGTCATGCAGGGTTC

60

~180

Abbas et al. [1]

MexB-R

TTACTGTTGCGGCGCAGGTGACT

60

~180

Figure 1: Results of the amplification of genes MexB of bacterial species were fractionated on a 2% agarose gel electrophoresis stained with Eth

Br M: 100 bp ladder marker, Lanes 1-10 resemble 180 bp PCR products, **(M = marker, P1-P10 = samples)

 

Table 3: Reaction setup

Master mix components

Stock

Unit

Final

Unit

Volume

1 Sample

Master Mix

2

X

1

X

10

Forward primer

10

µM

0.5

µM

1

Reverse primer

10

µM

0.5

µM

1

Nuclease free water

6

DNA

ng/µL

ng/µL

2

Total volume

20

Aliquot per single rxn

18 µL of Master mix per tube and add 2 µL of Template

 

Table 4: Conditions of PCR reaction for PhzM genes

Steps

Temperature (°C)

m:s

Cycle

Initial Denaturation

95

05:00

1

Denaturation

95

00:30

30

Annealing

50,55, 60

00:30

Extension

72

00:30

Final extension

72

07:00

1

Hold

10

10:00

 

Solutions

Ethidium bromide (10 mg/ml), a DNA ladder marker and 1 TAE buffer.

 

Preparation of Agarose

  • A flask containing 100 cc of 1X TAE was taken
  • The buffer was supplemented with 1.5 g (for 1.5%) agarose
  • Using a microwave, the mixture was brought to a boil until all of the gel particles were dissolved
  • To the agarose, 1 µL of Ethidium Bromide (10 mg/ml) was added
  • To mix the agarose and prevent bubbles, it was swirled
  • The mixture was allowed to cool between 50 and 60 degrees Celsius

 

Casting of the Horizontal Agarose Gel

After sealing both edges with cellophane tapes, the agarose solution was transferred into the gel tray and allowed to harden for half an hour at room temperature. After carefully removing the comb, the gel was put into the gel tray. 1X TAE-electrophoresis buffer was added to the tray until it covered the gel's surface by 3-5 mm [1].

 

DNA Loading

Direct loading of the PCR products was done. Five microliters of the PCR product were put straight into the well. For 60 minutes, electrical power was turned on at 100 v/m Amp. From the cathode to the positive anode poles, DNA travels. A gel imaging equipment was used to view the bands in the gel that were stained with ethidium bromide [15].

RESULTS

Sample Distribution: From the 100 clinical specimens collected, P. aeruginosa recorded a high percentage of isolates (67%), the number and percentage of P. aeruginosa isolates as shown in Table 5. All 67 isolates were obtained by cultural characterisation. These clinical isolates were on cetrimide agar, which is a selective medium for Pseudomonas spp. at 37°C for 24 hours.

 

Table 4: The sample distribution of P. aeruginosa isolates from different types of Specimens

Type of specimens

No. (Percentage)

Chronic burns swab

23 (34.3%)

Wounds swab

15 (22.4%)

Urine from UTI patients

12 (17.9%)

Sputum

10 (14.9%)

Ear swabs

7 (10.5%)

Total

67 (100.0 %)

Bacterial Detection: In this study, we used the VITEK2 compact System to confirm the diagnosis of Pseudomona aeruginosa probability is approximately 93%-98% that all seven isolates are identified as Pseudomonas aeruginosa detection.

Molecular Detection of P. aeruginosa MexB gene

Ten identical isolates of P. aeruginosa were used in this investigation. The presence of the mexB gene in 67 clinical isolates of P. aeruginosa has been found using PCR. An active efflux pump system was indicated by the analysis of 67 (100%) culture-positive isolates. All 67 isolates had the MexB gene. Notably, the gene band did not smear, indicating that there was no indication of DNA degradation.

DISCUSSION

This high prevalence indicates that P. aeruginosa remains a major opportunistic pathogen in clinical infections, especially in hospitalised patients. The isolates were initially cultured on Cetrimide agar, a selective medium that enhances the isolation of Pseudomonas spp. by inhibiting the growth of most other bacteria. The use of incubation at 37°C for 24 hours aligns with the optimal growth conditions for P. aeruginosa.

 

For confirmation, the VITEK2 Compact System was employed, yielding a high probability of identification (93%-98%) for P. aeruginosa. This level of diagnostic accuracy reflects the reliability of automated identification systems, especially when coupled with initial cultural characteristics.

 

These findings are consistent with several previous studies. For example, a study conducted by Al-Muhanna et al. [16] in Iraq reported that P. aeruginosa was isolated in 65% of clinical samples, especially from wound infections and respiratory tract specimens. Similarly, Khan et al. [17] found a prevalence rate of 70% for P. aeruginosa among nosocomial infections, confirming the organism’s significant role in hospital-acquired infections [18].

 

The high isolation rate in our study might be attributed to several factors, including:

  • The intrinsic resistance of aeruginosa to multiple antibiotics
  • Its ability to survive in moist hospital environments

 

The compromised immune status of many hospitalized patients, particularly those with burns, ventilator-associated pneumonia, or urinary catheters [19].

 

Moreover, the successful use of selective media such as Cetrimide agar and confirmatory tools like VITEK2 enhances the accuracy of detection, reducing false positives or negatives compared to traditional biochemical testing. In contrast, some studies report slightly lower isolation rates, likely due to differences in sample types, patient demographics, or hospital infection control practices. For instance, Ahmed et al. [20] reported a 50% isolation rate in a study conducted in a tertiary care centre in Jordan.

 

Overall, the results of this study align closely with regional and international findings, highlighting P. aeruginosa as a critical pathogen that requires continuous monitoring and strict infection control strategies.

 

Molecular Detection of P. aeruginosa MexB gene:In the present study, the MexB gene, a key component of the MexAB-OprM efflux pump system, was detected in all 67 clinical isolates of Pseudomonas aeruginosa using PCR analysis. The amplification results showed clear, sharp DNA bands without smearing, confirming high-quality DNA extraction and integrity with no significant degradation.

 

The detection of the MexB gene in 100% of the isolates strongly suggests that the MexAB-OprM efflux system is universally present among the clinical strains investigated. This finding is consistent with the known role of MexAB-OprM as a constitutively expressed efflux pump in P. aeruginosa, which is crucial for intrinsic resistance to multiple classes of antibiotics, including β-lactams, fluoroquinolones, tetracyclines and chloramphenicol [17].

 

The presence of an active efflux system across all isolates indicates that efflux-mediated antibiotic resistance is a widespread and significant mechanism in clinical P. aeruginosa strains. The efficiency of this pump contributes heavily to the bacterium’s ability to survive antibiotic pressure in hospital settings, leading to therapeutic challenges and persistent infections.

 

These findings are in agreement with previous studies, such as Poole [21] reported that MexAB-OprM is the most consistently expressed efflux system in P. aeruginosa and plays a central role in intrinsic multidrug resistance. Zhang et al. [22] demonstrated that 95-100% of clinical P. aeruginosa isolates harboured the mexB gene, confirming its essential function in resistance patterns globally. In a local study from Iraq, Al-Muhanna et al. [16] similarly found a high prevalence of efflux-related genes, including mexB, among clinical isolates.

 

The absence of DNA smearing further validates the quality of molecular procedures, ensuring that PCR results are reliable [23,24]. Moreover, the robust presence of MexB across all isolates highlights the necessity of considering Efflux Pump Inhibitors (EPIs) as a potential adjunctive strategy to restore antibiotic susceptibility in resistant P. aeruginosa infections [25]. In contrast, some studies have noted occasional downregulation or mutation of the mexB gene, particularly under specific selective pressures or mutations affecting the regulatory genes (e.g., mexR), although such phenomena were not observed in this study.

CONCLUSIONS

This study showed a high prevalence (67%) of Pseudomonas aeruginosa in clinical specimens, confirmed with high accuracy by the VITEK2 system. All isolates carried the MexB efflux pump gene, highlighting its major role in antibiotic resistance. The presence of MexB within the MexAB-OprM operon increases drug expulsion, contributing to multidrug resistance, especially dangerous for immunocompromised patients like burn victims, newborns and cancer patients. Detection of efflux pump genes by PCR provides rapid insight into emerging resistance.Effective infection control, continuous surveillance and development of therapies targeting efflux mechanisms are critical to managing P. aeruginosa infections.

REFERENCES

1. Abbas, Hisham A. “Phenotypic and genotypic detection of antibiotic resistance of Pseudomonas aeruginosa isolated from urinary tract infections.” African Health Sciences, vol. 18, no. 1, March 2018, pp. 11-21. https://pubmed.ncbi.nlm.nih.gov/ 29977252/.

2. Zeng, Zhang-Rui “Mechanisms of carbapenem resistance in cephalosporin-susceptible Pseudomonas aeruginosa in China.” Diagnostic Microbiology and Infectious Disease, vol. 78, no. 3, March 2014, pp. 268-270. https://pubmed.ncbi. nlm.nih.gov/24359931/.

3. Khulaif, Mohammed Jasim and Alaa H. Al-Charrakh. “Detection of Class 1 Integron and Antibiotic Resistance of β-Lactamase-Producing Escherichia coli Isolated from Four Hospitals in Babylon, Iraq.” Medical Journal of Babylon, vol. 20, no. 2, April 2023, pp. 375-382. https://journals. lww.com/mjby/fulltext/2023/20020/detection_of_class_1_integron_and_antibiotic.28.aspx.

4. Ibrahim, Baidaa Adel and Mayadaa Abdullah Shehan “Expression Levels of Efflux pump mexR and norA Genes in Multi-Drug Resistant in Some Bacteria by Using Quantitative RT-PCR Under Stress of Effect Efflux Pump Inhibitors.” Medico Legal Update, vol. 21, no. 1, 2021, pp. 1486-1492. https://ijop.net/index.php/mlu/article/view/ 2532.

5. Wi, Yu Mi et al. “Activity of Ceftolozane-Tazobactam against Carbapenem-Resistant, Non-Carbapenemase-Producing Pseudomonas aeruginosa and Associated Resistance Mechanisms.” Antimicrobial Agents and Chemotherapy, vol. 62, no. 1, December 2017. https://journals.asm.org/doi/10.1128/aac.01970-17.

6. Suresh, M. et al. “Mutational analyses of regulatory genes, mexR, nalC, nalD and mexZ of mexAB-oprM and mexXY operons, in efflux pump hyperexpressing multidrug-resistant clinical isolates of Pseudomonas aeruginosa.” World Journal of Microbiology and Biotechnology, vol. 34, May 2018. https://link.springer.com/ article/10.1007/s11274-018-2465-0.

7. Nayak, Sumitha et al. “Role of Faropenem in treatment of pediatric infections: The current state of knowledge.” Cureus, vol. 14, no. 4, April 2022. https://pmc. ncbi.nlm.nih.gov/articles/PMC9045788/.

8. Abdallah, Alshimaa L. et al. “Expression of MexAB-OprM efflux pump system and meropenem resistance in Pseudomonas aeruginosa isolated from surgical intensive care unit.” Microbes and Infectious Diseases, vol. 2, no. 4, April 2022, pp. 781-789. https://mid.journals.ekb.eg/article_ 195678_177cc8df9008e46a832dd0cec29f70d0.pdf.

9. Nogbou, Noel-David et al. “Efflux Pump Activity and Mutations Driving Multidrug Resistance in Acinetobacter baumannii at a Tertiary Hospital in Pretoria, South Africa.” International Journal of Microbiology, vol. 2021, October 2021. https://pubmed.ncbi.nlm.nih.gov/34659419/.

10. Kasoob, Diana Sami and Esam Hamid Hummadi. "Expression of rhlR gene in Pseudomonas aeruginosa affected by Lactobacillus spp." Journal of Pharmaceutical Negative Results, vol. 13, no. 3, 2022.

11. Al-Anssari, Mohammed Jaafar and Alaa H. Al-Charrakh. “Flagellin b Shifting the Immune Response Against P. aeruginosa Respiratory Infections from Chronic to Cure State.” Latin American Journal of Pharmacy, vol. 42, no. Special issue, 2023, pp. 55-60. http://www.latamjpharm.org/ resumenes/0/3/LAJOP_0_3_1_12.pdf.

12. Wen, Hainan et al. “Direct identification, antimicrobial susceptibility testing and extended-spectrum β-lactamase and carbapenemase detection in Gram-negative bacteria isolated from blood cultures.” Infection and Drug Resistance, vol. 15, 2022, pp. 1587-1599. https://pubmed.ncbi.nlm.nih.gov/ 35418761/.

13. AL-Mayyahi, Anmar W. “Direct identification, antimicrobial susceptibility testing and extended-spectrum β-lactamase and carbapenemase detection in Gram-negative bacteria isolated from blood cultures.” Iraqi Journal of Biotechnology, vol. 17, 2018. https://jige.uobaghdad.edu.iq/index.php/IJB/article/ view/28.

14. Abdel-Salam, Shimaa et al. “Association between MexA/MexB efflux-pump genes with the resistance pattern among Pseudomonas aeruginosa isolates from Ain Shams University Hospitals.” Microbes and Infectious Diseases, vol. 4, no. 1, February 2023, pp. 160-167. https://mid.journals.ekb.eg/article_266455.html.

15. Pesingi, Prasanna Vadhana et al. “MexAB-OprM Efflux Pump of Pseudomonas aeruginosa Offers Resistance to Carvacrol: A Herbal Antimicrobial Agent.” Frontiers in Microbiology, vol. 10, November 2019. https://pubmed.ncbi.nlm.nih.gov/ 31803171/.

16. Jameel, Zainab Hafedh et al. “Molecular detection of efflux pump genes (MexAB-OprM) in Pseudomonas aeruginosa isolated form Babylon Province.” Medical Journal of Babylon, vol. 20, no. 4, October 2023, pp. 732-738. https://journals.lww.com/mjby/fulltext/2023/20040/ molecular_detection_of_efflux_pump_genes.12.aspx.

17. Schwartz, Beth et al. “Multidrug Resistant Pseudomonas aeruginosa in Clinical Settings: A Review of Resistance Mechanisms and Treatment Strategies.” Pathogens, vol. 13, no. 11, November 2024. https://pubmed.ncbi.nlm.nih. gov/39599528/.

18. Al-Zwaid, Afrah Jawad Abd et al. “Molecular investigation of Pseudomonas aeruginosa mexAB-oprM efflux pump genes from clinical samples and their correlation with antibiotic resistance.” Journal of Applied & Natural Science, vol. 14, no. 1, March 2022, pp. 140-147. https://journals.ansfoundation. org/index.php/jans/article/view/3240.

19. Al Muqati, Hessa et al. “Superinfection rate among the patients treated with carbapenem versus piperacillin/tazobactam: Retrospective observational study.” Journal of Infection and Public Health, vol. 14, no. 3, March 2021, pp. 306-310. https://pubmed.ncbi.nlm.nih.gov/33618274/.

20. Ahmed, S.M. “Prevalence of antibiotic resistance and virulent factors in nosocomial Pseudomonas aeruginosa isolates from tertiary care hospitals in Jordan.” Journal of Infection and Public Health, vol. 12, no. 6, 2019, pp. 843-848.

21. Poole, Keith. “Multidrug efflux pumps and antimicrobial resistance in Pseudomonas aeruginosa and related organisms.” Journal of Molecular Microbiology and Biotechnology, vol. 3, no. 2, March 2021, pp. 255-264. https://pubmed.ncbi.nlm.nih.gov/11321581/.

22. Zhang, L. and T.F. Mah. “Involvement of MexAB-OprM in Resistance to Carbapenem Antibiotics in Clinical Pseudomonas aeruginosa Isolates.” Antimicrobial Agents and Chemotherapy, vol. 65, no. 3, 2021.

23. Salumi, Zina N. and Zainab H. Abood. “Phenotypic Diagnosis of Efflux Pump of Escherichia coli Isolated from Urinary Tract Infections.” Iraqi Journal of Biotechnology, vol. 21, no. 2, 2022, pp. 21-31. https://jige.uobaghdad.edu.iq/index. php/IJB/article/view/473.

24. Gawad, Mohammed A. and Wasan A. Gharbi. “Molecular Detection of oprI and oprL Virulence Genes of Pseudomonas aeruginosa Isolated from Burns and Wounds.” Iraqi Journal of Biotechnology, vol. 21, no. 2, 2022, pp. 215-224. https://jige.uobaghdad.edu.iq/index.php/IJB/article/view/497.

25. Sambrano, Héctor et al. “Prevalence of antibiotic resistance and virulent factors in nosocomial clinical isolates of Pseudomonas aeruginosa from Panamá.” The Brazilian Journal of Infectious Diseases, vol. 25, no. 1, January 2021. https://www.sciencedirect.com/science/article/pii/S1413867020301653.

Recommended Articles
Research Article In-Press

Assessment of Knowledge and Feeding Performance of Caregivers Regarding Iron Deficiency Anaemia Among Children Aged 12–59 Months: A Cross-Sectional Study in Erbil, Iraq

pdf Download PDF
Research Article

Green Synthesis of Cobalt Ferrite (CoFe₂O₄) Nanoparticles Utilising Co-Precipitation, Structural Features and Toxicological Evaluation against MCF-7 and HUVEC Cell Lines

...
Published: 05/05/2026
pdf Download PDF
Research Article

Assessment of Community Response and Effectiveness of Malaria Control and Management Programs

...
Published: 05/05/2026
pdf Download PDF
Research Article

Serum Chemerin, Osteopontin, IL-3 and IFN-γ as Diagnostic Biomarkers for Breast Cancer in Iraqi Women: A Comparative Cross-Sectional Study

...
Published: 05/05/2026
pdf Download PDF
Copyright © Journal of Pioneering Medical Sciences until unless otherwise.