Research Article | | Volume 15 Issue 6 (June, 2026) | Pages 186 - 192

Phenotypic and Molecular Characterization of Multidrug Resistant Staphylococcus Aureus Isolates from Clinical Samples in Diyala, Iraq

 ,
 ,
1
General Directorate of Education in Diyala, Diyala, Iraq
Under a Creative Commons license
Open Access
Received
Jan. 30, 2026
Revised
Feb. 4, 2026
Accepted
June 10, 2026
Published
July 5, 2026

Abstract

A total of 250 clinical specimens (burns, wounds, urine, blood, nasal swabs, middle-ear discharge, throat swabs and sputum were collected from inpatients and outpatients of both sexes and all age groups at Al-Batool Maternity and Children Hospital and Baqubah Teaching Hospital, Diyala Governorate, between November 2024 and March 2025. Eighty isolates were identified as Staphylococcus aureus on the basis of phenotypic, cultural and biochemical characteristics and identification was confirmed using the VITEK-2-Compact system. Susceptibility to 12 antimicrobial agents was determined by the Kirby-Bauer disc diffusion method and inhibition zones were interpreted according to current Clinical and Laboratory Standards Institute (CLSI) criteria. The highest resistance was recorded against oxacillin (90%), followed by amoxicillin and ceftriaxone (86.25% each) and ampicillin (78.75%); resistance to erythromycin and azithromycin was 67.5%, to levofloxacin 42.5%, to ciprofloxacin and trimethoprim-sulfamethoxazole 40% and to amikacin and gentamicin 38.75% and 37.5%, respectively. The lowest resistance was observed against vancomycin (12.5%). Applying the international criteria of Maiorano’s et al. (2012), 61 isolates (76.25%) were classified as multidrug-resistant (MDR), 7 (8.75%) as extensively drug resistant (XDR) and the remaining 12 (15%) as non-MDR. Phenotypic screening showed that all isolates produced β-haemolysis, coagulase and gelatinase (100%), whereas extended-spectrum β-lactamase (ESβL), metalo-β-lactamase (MβL) and class C β-lactamase (AmpC) were detected in 34 (42.5%), 51 (63.75%) and 62 (77.5%) of isolates, respectively. To explore the genetic basis of sulphonamide resistance, the DNA of 16 representative MDR isolates was screened by polymerase chain reaction (PCR); sul1 was detected in 6 isolates (37.5%) and sul2 in 7 isolates (43.75%). Because the molecular analysis was restricted to this purposively selected subset, the genotypic findings should be interpreted as indicative rather than representative of all isolates. Overall, the study documents a high burden of MDR S. aureus in clinical settings in Diyala and provides preliminary evidence linking phenotypic sulphonamide resistance to the carriage of sul1 and sul2, supporting the need for continued antimicrobial surveillance and stewardship.

Keywords
Staphylococcus Aureus, Antimicrobial Resistance, Multidrug Resistance, Virulence Factors, Sulphonamide Resistance Genes

INTRODUCTION

Staphylococcus aureus is among the most clinically important human pathogens and a leading cause of both hospital-acquired and community-acquired infections [1]. Although it commonly colonizes the skin and mucosae as part of the normal flora, it readily behaves as an opportunistic pathogen and invades virtually any tissue when host barriers are breached [2]. Clinically, isolates are broadly categorized as methicillin-susceptible (MSSA) or methicillin-resistant (MRSA), the latter representing a particularly serious therapeutic challenge [3]. Globally, MRSA has shown the largest increase in attributable mortality of any resistant pathogen, being associated with approximately 130,000 deaths in 2021 more than double the figure recorded three decades earlier which underscores the urgency of regional surveillance [4].

 

The pathogenic success of S. aureus reflects an extensive armamentarium of virulence factors, including toxins and extracellular enzymes that promote tissue invasion and immune evasion, together with a marked capacity to acquire resistance to multiple antimicrobial classes, particularly β-lactams and aminoglycosides [5]. The organism also forms structured biofilms of extracellular polymeric substances that shield embedded cells from desiccation, nutrient limitation and, critically, antibacterial agents, thereby facilitating persistence and recurrent infection [6]. The progressive erosion of treatment options extending even to vancomycin, the mainstay against MRSA has transformed staphylococcal resistance into a pressing public-health problem [7].

 

Sulphonamide resistance determinants, notably sul1 and sul2, encode drug-insensitive dihydropteroate synthases and are among the most widely disseminated, horizontally transferable resistance genes. They are frequently integron associated and co-selected with other resistance determinants, which makes them informative markers of mobile resistance. While these genes have been characterized extensively in Gram-negative bacteria, their distribution in clinical S. aureus, especially in relation to phenotypic resistance against trimethoprim-sulfamethoxazole remains comparatively underexplored and local data from Diyala are scarce. Addressing this gap, rather than re-documenting overall resistance rates already reported in regional surveillance, constitutes the principal contribution of the present work.

 

Accordingly, this study was designed to characterize the phenotypic antimicrobial-resistance patterns of S. aureus recovered from diverse clinical sources and to determine the prevalence of MDR and XDR phenotypes among the isolates. A further objective was to screen a representative subset of MDR isolates for the sulphonamide resistance genes sul1 and sul2 and to assess their association with the observed phenotypic resistance to trimethoprim-sulfamethoxazole. We hypothesized that clinical S. aureus isolates in this setting display a high prevalence of MDR phenotypes and that phenotypic sulphonamide resistance is accompanied by carriage of sul1 and/or sul2.

METHODS

Study Design, Setting and Ethical Approval

This cross-sectional study was carried out at Al-Batool Maternity and Children Hospital and Baqubah Teaching Hospital, Diyala Governorate, Iraq, between November 2024 and March 2025. The study was conducted in accordance with the principles of the Declaration of Helsinki and was approved by the institutional ethics committee; oral informed agreement was obtained from participants prior to specimen collection.

 

Sample Collection and Inclusion/Exclusion Criteria

A total of 250 clinical specimens (burns, wounds, urine, blood, nasal swabs, middle ear discharge, throat swabs and sputum) were collected from inpatients and outpatients of both sexes and all age groups with clinically suspected bacterial infection during the study period. Specimens yielding no growth, mixed or contaminated cultures and duplicate isolates obtained from the same patient were excluded; only the first S. aureus isolate per patient was maintained for analysis. Because all eligible serial specimens during the defined period were registered, sampling was repeated.

 

Identification of Isolates

Isolates were presumptively identified as S. aureus on the basis of colonial morphology on blood agar and mannitol salt agar, Gram staining and conventional biochemical tests (catalase, oxidase, coagulase and motility). Identification was subsequently confirmed using the VITEK-2 Compact automated system (bioMérieux, France).

 

Antimicrobial Susceptibility Testing

Susceptibility to 12 antimicrobial agents was determined by the Kirby Bauer disc diffusion method on Mueller-Hinton agar [8]. Commercially prepared discs were applied at the following potencies: amikacin (30µg), gentamicin (10µg), ciprofloxacin (5µg), levofloxacin (5µg), amoxicillin (25µg), oxacillin (1µg), ampicillin (10µg), ceftriaxone (30µg), vancomycin (30µg), erythromycin (15µg), azithromycin (15µg) and trimethoprim-sulfamethoxazole (1.25/23.75µg). Inhibition-zone diameters were measured after 16-24 h of incubation at 35±2 °C and interpreted as susceptible, intermediate or resistant according to the current breakpoints of the Clinical and Laboratory Standards Institute [9].

 

Definition of MDR and XDR

Isolates were classified according to the internationally accepted criteria of Magiorakos et al. [10]. Multidrug resistance (MDR) was defined as acquired non-susceptibility to at least one agent in three or more antimicrobial categories and extensive drug resistance (XDR) as non-susceptibility to at least one agent in all but two or fewer categories. Isolates that did not meet the MDR criterion (non-susceptible to ≤2 categories or susceptible to all agents tested) were designated non-MDR. These definitions were applied consistently throughout the analysis.

 

Phenotypic Detection of Virulence Factors and Resistance Enzymes

All 80 isolates were screened phenotypically for production of β-haemolysis, coagulase and gelatinase and for the elaboration of extended-spectrum β-lactamase (ESβL), metalo-β-lactamase (MβL) and class C β-lactamase (AmpC) using standard plate- and inhibitor-based assays.

 

Bacterial DNA extraction

Sixteen isolates were purposively selected from the MDR group to represent the range of clinical sources and resistance profiles, with the aim of examining the carriage of the sulphonamide resistance determinants sul1 and sul2. Genomic DNA was extracted using the Presto™ Mini gDNA Bacterial Kit for Gram-positive bacteria following the manufacturer's instructions (Bioneer, Korea). DNA concentration and purity were assessed with a NanoDrop spectrophotometer (ACTGene, Taiwan); an A260/280 ratio of 1.6-1.9 was adopted as the criterion for high-purity DNA suitable for amplification.

 

Detection of Target Genes by PCR

The extracted DNA was used to detect the target genes in a 25-µL reaction (Table 1), with gene specific primers (Table 2) and thermal-cycling conditions (Table 3). Following amplification, 5 µL of each product was resolved by agarose-gel electrophoresis and visualized under ultraviolet illumination.

 

Table 1: Composition of the PCR reaction mixture.

No.

Reaction component

Volume (µL)

1

Forward primer

1.0

2

Reverse primer

1.0

3

Template DNA

1.5

4

Nuclease-free deionized water

16.5

5

GoTaq Green Master Mix

5.0

Total volume

25.0

 

Table 2: Nucleotide primer sequences used in the study.

Primer

Sequence (5′→3′)

Product (bp)

Annealing (°C)

Reference

sul1-F

TGGTGACGGTGTTCGGCATTC

789

55

Ferri et al. [35]

sul1-R

GCGAGGGTTTCCGAGAAGGTG

-

-

sul2-F

TCAACATAACCTCGGACAGT

707

53

Peng et al. [36]

sul2-R

GATGAAGTCAGCTCCACCT

-

-

 

Table 3: Thermal-cycling conditions for uniplex PCR amplification.

Gene

Initial denat.

Cycles

Denaturation

Annealing

Elongation

Final ext.

sul1

94 °C / 5 min

35

94 °C / 50 s

55 °C / 50 s

72 °C / 1 min

72 °C / 7 min

sul2

94 °C / 5 min

35

94 °C / 1 min

53 °C / 45 s

72 °C / 1 min

72 °C / 7 min

 

Statistical Analysis

Data were analysed using SPSS (version 2019). The chi-square (χ²) test was used to compare proportions among qualitative variables, with statistical significance set at p≤0.05 and p≤0.01.

RESULTS AND DISCUSSION

Identification and Isolation

Of the 250 specimens cultured, 229 (91.6%) were culture-positive and 21 (8.4%) were culture-negative. Staphylococcus aureus accounted for 80 isolates (32%), while 149 specimens (59.6%) yielded other bacterial species. Presumptive identification was based on colonial, microscopic and biochemical characteristics following growth on blood agar and mannitol salt agar under aerobic conditions at 37°C for 24hrs. On blood agar, colonies were convex, glistening, smooth-edged and whitish to golden-yellow, with complete β-haemolysis, consistent with the findings of Delost et al. [11] (Table 4).

 

Table 4: Preliminary diagnostic test results for S. aureus.

No.

Test

Result

1

Gram stain

+

2

Cell shape and arrangement

Grape-like clusters

3

Mannitol salt agar

Golden-yellow colonies

4

Catalase

+

5

Oxidase

6

Coagulase

+

7

Motility

8

Haemolysin

β-haemolysis

 

Definitive identification of all 80 isolates was achieved with the VITEK 2 Compact system, which confirms presumptive culture-, microscopy- and biochemistry-based diagnoses with reported accuracy up to 99%. The number of infections was higher among females (45 isolates, 56.25%) than males (35 isolates, 43.75%), although the difference was not statistically significant (Table 5).

 

This pattern is consistent with Al-Fayyad [12], who, working on S. aureus from clinical samples in Diyala, reported isolation rates of 56.36% in females and 43.64% in males. The slightly higher recovery from females may reflect differences in physiological, immunological and genetic predisposition, unequal sample sizes and variation in sampling time and site, as well as the larger number of female attendees during the collection period [13]. Greater occupational exposure of women to detergents and chemicals and differences in the composition of the resident skin flora between sexes, have also been proposed as contributing factors [14].

 

Table 5: Distribution of S. aureus isolates by sex.

Sex

Number

Percentage

Males

35

43.75

Females

45

56.25

Total

80

100

χ² (p-value)

1.250 NS (0.263)

NS = not significant

 

Distribution of Isolates by Source of Infection

The largest proportion of S. aureus isolates originated from wounds (n=20, 25%), followed by urine (n=15, 18.75%), burns and blood (n=12, 15%), nasal swabs (n=9, 11.25%), middle-ear discharge (n=6, 7.5%), throat (n=5, 6.25%) and sputum (n=1, 1.25%). The distribution was statistically significant (χ² = 8.218, p≤0.01) (Table 6).

 

Table 6: Distribution of S. aureus isolates according to source of infection.

Source

Number

Percentage

Wounds

20

25

Urine

15

18.75

Burns

12

15

Blood

12

15

Nasal swab

9

11.25

Otitis media

6

7.5

Throat

5

6.25

Sputum

1

1.25

Total

80

100

χ² (p-value)

8.218 ** (0.0072)

-

** P ≤ 0.01

 

The predominance of S. aureus in wound infections is consistent with its status as a skin commensal capable of breaching the cutaneous barrier and colonizing wound beds. It is the organism most frequently recovered from post-operative wound infections, reflecting its abundant invasive and virulence determinants [15]. The present finding aligns with Hatem et al. [16], who reported the highest isolation rate from wounds (45.83%) and with Al-Hayali [17], who recorded 57.1% from wound samples. It contrasts, however, with Yassin et al. [18] and Ahmed [19], who found burns to be the principal source (29.67% and 30%, respectively) a deviation likely attributable to differences in patient populations, ward case mix and local infection control practices across centres.

 

Antimicrobial Susceptibility

The isolates displayed heterogeneous resistance across the 12 agents tested (Table 7). These agents were selected because they are commonly used against staphylococcal infections, allowing the extent and potential dissemination of resistance to be assessed.

 

Table 7: Antimicrobial susceptibility profile of the 80 S. aureus isolates.

Antimicrobial class

Agent (disc potency)

Resistant N (%)

Intermediate N (%)

Sensitive N (%)

χ², df (P-value)

Aminoglycosides

Amikacin (30 µg)

31 (38.75)

18 (22.5)

31 (38.75)

4.275, 2 (0.117) NS

Gentamicin (10 µg)

30 (37.5)

3 (3.75)

47 (58.75)

34.741, 2 (<0.0001) **

Fluoroquinolones

Ciprofloxacin (5 µg)

32 (40)

13 (16.25)

35 (43.75)

10.675, 2 (<0.0001) **

Levofloxacin (5 µg)

34 (42.5)

8 (10)

38 (47.5)

19.920, 2 (<0.0001) **

β-Lactams (penicillins)

Amoxicillin (25 µg)

69 (86.25)

4 (5)

7 (8.75)

100.98, 2 (<0.0001) **

Oxacillin (1 µg)

72 (90)

0 (0)

8 (10)

116.8, 2 (<0.0001) **

Ampicillin (10 µg)

63 (78.75)

6 (7.5)

11 (13.75)

74.725, 2 (<0.0001) **

β-Lactams (cephalosporins)

Ceftriaxone (30 µg)

69 (86.25)

3 (3.75)

8 (10)

100.98, 2 (<0.0001) **

Glycopeptides

Vancomycin (30 µg) †

10 (12.5)

0 (0)

70 (87.5)

107.5, 2 (<0.0001) **

Macrolides

Erythromycin (15 µg)

54 (67.5)

19 (23.75)

7 (8.75)

44.725, 2 (<0.0001) **

Azithromycin (15 µg)

54 (67.5)

6 (7.5)

20 (25)

45.700, 2 (<0.0001) **

Folate-pathway antagonist

Trimethoprim-sulfamethoxazole (25 µg)

32 (40)

1 (1.25)

47 (58.75)

41.275, 2 (<0.0001) **

*p≤0.05, **p≤0.01, NS = not significant. Vancomycin was tested by disc diffusion; CLSI recommends confirmation by a minimum inhibitory-concentration method.

 

Resistance was highest against oxacillin (90%), followed by amoxicillin and ceftriaxone (86.25% each), ampicillin (78.75%), erythromycin and azithromycin (67.5% each), levofloxacin (42.5%), ciprofloxacin and trimethoprim-sulfamethoxazole (40% each), amikacin (38.75%) and gentamicin (37.5%). Vancomycin retained the greatest activity, with only 12.5% of isolates classified as resistant. The marked β-lactam resistance is consistent with the high prevalence of MRSA-associated phenotypes observed in this collection.

 

The therapeutic history of S. aureus has been one of successive antibiotic introduction followed by rapid resistance emergence since the advent of penicillin, generating sustained clinical challenges [20]. The 90% oxacillin resistance recorded here is comparable with Al-Taey [21] and Fitranda et al. [22], who reported 92.5% and 90%, respectively, but exceeds the rates of Jabr [23] in Diyala (75%) and Ahmed [19] in Baghdad (76%) and the 65.7% reported from Iran by Ghari et al. [24]. Such variation between geographically proximate studies likely reflects differences in patient populations, antibiotic-prescribing pressure and the local circulation of MRSA clones.

 

Variable aminoglycoside resistance was also observed. In S. aureus, resistance to amikacin and gentamicin is typically mediated by aminoglycoside-modifying enzymes (acetyltransferases, phosphotransferases and nucleotidyl-transferases) encoded on mobile genetic elements, supplemented by reduced membrane permeability, efflux and target-site mutation [25]. The co-occurrence of these mechanisms with β-lactam resistance is consistent with the multidrug-resistant phenotype that predominated in this collection.

 

Multidrug Resistance in Staphylococcus Aureus

Most isolates were non-susceptible to at least one agent in three or more antimicrobial categories. Applying the criteria of Magiorakos et al. [10], 61 of the 80 isolates (76.25%) were classified as MDR and 7 (8.75%) as XDR (non-susceptible to all but ≤2 categories); the remaining 12 (15%) were non-MDR (resistant to ≤2 categories or fully susceptible). The distribution was highly significant (χ² = 67.457, p≤0.01) (Table 8).

 

Table 8: Resistance patterns among the 80 S. aureus isolates.

Resistance pattern

N (%)

Multidrug-resistant (MDR)

61 (76.25)

Extensively drug-resistant (XDR)

7 (8.75)

Non-MDR

12 (15)

χ² (p-value)

67.457 ** (0.0001)

**p≤0.01

 

These results are consistent with two earlier Baqubah studies: Mohammed [26] reported MDR in 96% and XDR in 10% of S. aureus isolates, while Jasim and Alzubaidy [27] found that 82% were resistant to all tested antibiotics, with 14% meeting the XDR criterion. The emergence and intramural spread of MDR S. aureus is a major concern because it narrows therapeutic options and is associated with increased mortality, particularly among critically ill patients. The principal drivers are repeated and unregulated antibiotic use, including community self-medication without susceptibility testing, which selects for resistant subpopulations [28]. From a clinical standpoint, the 76.25% MDR prevalence reported here implies that empirical β-lactam therapy is likely to fail in most cases, reinforcing the value of local antibiograms, vancomycin stewardship and strict infection-control measures.

 

Phenotypic Detection of Virulence Factors and Resistance Enzymes

All 80 isolates were assessed for haemolysin, coagulase and gelatinase production and for ESβL, MβL and AmpC activity (Table 9). β-Haemolysis, coagulase and gelatinase were produced by all isolates (100%), whereas AmpC, MβL and ESβL were detected in 62 (77.5%), 51 (63.75%) and 34 (42.5%) isolates, respectively. Differences were significant for all enzymes except ESβL.

 

Table 9: Phenotypic detection of virulence factors and resistance enzymes in the 80 S. aureus isolates.

Result

Gelatin hydrolysis (%)

β-Haemolysis (%)

Coagulase (%)

AmpC β-lactamase (%)

Metallo-β-lactamase (%)

Extended-spectrum β-lactamase (%)

Producer

80 (100)

80 (100)

80 (100)

62 (77.5)

51 (63.75)

34 (42.5)

Non-producer

0

0

0

18 (22.5)

29 (36.25)

46 (57.5)

Total

80

80

80

80

80

80

χ² (P-value)

62.750 ** (0.0001)

62.750 ** (0.0001)

62.750 ** (0.0001)

24.20 ** (0.0001)

6.050 * (0.0136)

1.80 NS (0.179)

*p≤0.05, **p≤0.01, NS = not significant

 

DNA Extraction and Molecular Screening

Genomic DNA was successfully extracted from the S. aureus isolates using the Presto™ Mini gDNA Bacterial Kit, yielding high-purity preparations with A260/280 ratios of 1.6-1.9. Integrity was verified by electrophoresis on 1.5% agarose at 70 V for 60 min, followed by ultraviolet visualization (Figure 1). Sixteen isolates (SA1, SA6, SA13, SA18, SA25, SA33, SA45, SA48, SA54, SA62, SA65, SA67, SA69, SA71, SA75 and SA78) were selected for molecular analysis on the basis of representative clinical sources, pronounced multidrug resistance and the production of multiple virulence factors and were screened for the sulphonamide resistance genes sul1 and sul2 using gene specific primers.

 

 

Figure 1: Agarose-gel electrophoresis (1.5% agarose, 7 V cm⁻¹, 60 min) for the sul1 gene. Lane M, molecular-size marker (100–1500 bp); lanes 5, 7, 9, 10, 13 and 15, isolates positive for sul1 (789 bp); lane N.C., negative control.

 

Detection of the Sulphonamide Resistance Genes Sul1 and Sul2

PCR screening of the 16 MDR isolates detected sul1 in 6 isolates (37.5%) and sul2 in 7 isolates (43.75%), with amplicons of the expected sizes (789 bp and 707 bp, respectively; Figure 1). The differences were not statistically significant (p = 0.317 and p = 0.617, respectively).

 

The carriage frequencies recorded here fall within the broad range reported internationally. A local study in Najaf [29] detected sul1 in 15% and sul2 in 50% of isolates, while studies in Pakistan (49.6% and 42.1%) [30] and Bangladesh (47.06% and 32.35%) [31] reported values comparable with the present findings. In contrast, much lower frequencies were observed in Nigeria (5.66%) [32] and China 28.21% [33] for sul1 and 10.26% for sul2), differences that probably reflect divergent sulphonamide-prescribing practices and the differing mobile-genetic-element repertoires circulating in each setting.

 

Collectively, with the phenotypic data, the molecular results offer a partial explanation for the observed sulphonamide resistance. Phenotypic resistance to trimethoprim-sulfamethoxazole reached 40% across the whole collection and sul1 and/or sul2 were present in a substantial fraction of the molecularly screened MDR isolates, indicating that these determinants contribute to the resistance phenotype. The concordance is, however, incomplete: sul genes confer resistance only to the sulfamethoxazole component, so resistance to the trimethoprim moiety mediated by dfr genes (e.g. dfrAdfrGdfrK) and other mechanisms are likely to operate in parallel. Consequently, sul-positive isolates may not invariably be phenotypically resistant and some phenotypically resistant isolates may lack sul genes. These observations argue for broader genotypic screening, including dfr determinants, to fully resolve the genotype-phenotype relationship.

 

The sul1 and sul2 genes are commonly found in staphylococci, including multidrug-resistant S. aureus. Their presence complicates therapy because the same isolates frequently co-harbour resistance to other classes such as β-lactams and, occasionally, glycopeptides [34].

CONCLUSIONS

This study showed a high prevalence of multidrug resistance among clinical S. aureus isolates in Diyala, with wounds the most frequent source of isolation. Phenotypic testing revealed substantial resistance to β-lactams and several other commonly prescribed agents, while vancomycin retained comparatively greater activity. Molecular screening of a representative subset of MDR isolates detected the sulphonamide resistance genes sul1 and sul2, providing preliminary genetic support for the observed phenotypic resistance to trimethoprim-sulfamethoxazole. Given that this genotypic analysis was limited to 16 isolates, the molecular findings are best regarded as indicative and warrant confirmation in larger, multi-centre cohorts. Collectively, the results emphasize the growing burden of antimicrobial resistance in S. aureus and the need for continued surveillance, rational antibiotic use and effective infection-control strategies to limit the spread of resistant strains.

 

Limitations

Several limitations should be acknowledged. First, the study was confined to two hospitals within a single governorate, which may limit the generalizability of the findings. Second, sampling was consecutive and no a priori sample-size or power calculation was performed. Third, the cross-sectional design captures resistance at a single point in time and cannot describe temporal trends. Fourth, molecular characterization was restricted to a purposively selected subset of 16 MDR isolates and to two sulphonamide determinants (sul1 and sul2); methicillin resistance markers (e.g. mecA/mecC) and trimethoprim (dfr) determinants were not assessed, so the genotypic findings should not be extrapolated to the full collection. Finally, vancomycin susceptibility was evaluated by disc diffusion; because CLSI recommends MIC testing for this antibiotic, the reported vancomycin results should be interpreted with caution and confirmed by an MIC-based method in future work.

REFERENCES

  1. Dotel, R. “Molecular epidemiology of Staphylococcus aureus and newer treatment strategies.” Doctoral dissertation, 2024.
  2. Touaitia, R. et al. “Staphylococcus aureus: A review of the pathogenesis and virulence mechanisms.” Antibiotics, vol. 14, no. 5, 2025, pp. 470. https://doi.org/10.3390/antibiotics14050470.
  3. Tariq, T.M. et al. “Frequency and antimicrobial susceptibility profile of methicillin-resistant Staphylococcus aureus isolated from pus and swab samples in a teaching hospital of Lahore.” International Journal of Pathology, 2024, pp. 24-29.
  4. Briki, A. et al. “Molecular epidemiology of methicillin-resistant Staphylococcus aureus in Gulf Cooperation Council countries (2010-2025): A scoping review.” Frontiers in Microbiology, vol. 16, 2025, pp. 1714252. https://doi.org/10.3389/fmicb.2025.1714252.
  5. Mlynarczyk-Bonikowska, B. et al. “Molecular mechanisms of drug resistance in Staphylococcus aureus.” International Journal of Molecular Sciences, vol. 23, no. 15, 2022, pp. 8088.
  6. Idrees, M.M. et al. “Prevalence of mecA- and mecC-associated methicillin-resistant Staphylococcus aureus in clinical specimens, Punjab, Pakistan.” Biomedicines, vol. 11, no. 3, 2023, pp. 878.
  7. Watanabe, S. et al. “Metabolic remodeling by RNA-polymerase gene mutations is associated with reduced β-lactam susceptibility in oxacillin-susceptible MRSA.” mBio, 2024, pp. e00339-24.
  8. Bauer, A.W. et al. “Antibiotic susceptibility testing by a standardized single disk method.” American Journal of Clinical Pathology, vol. 45, no. 4, 1966, pp. 493-496.
  9. Clinical and Laboratory Standards InstitutePerformance Standards for Antimicrobial Susceptibility Testing. 34th ed., CLSI Supplement M100, CLSI, 2024.
  10. Magiorakos, A.-P. et al. “Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance.” Clinical Microbiology and Infection, vol. 18, no. 3, 2012, pp. 268-281. https://doi.org/10.1111/j.1469-0691.2011.03570.x.
  11. Delost, G.R. et al. “Staphylococcus aureus carriage rates and antibiotic resistance patterns in patients with acne vulgaris.” Journal of the American Academy of Dermatology, vol. 74, no. 4, 2016, pp. 673-678.
  12. Al-Fayyad, M.N.I. “Molecular investigation of some virulence factors of Staphylococcus aureus isolated from different clinical samples.” College of Education for Pure Sciences, University of Diyala, PhD dissertation, 2021. [In Arabic].
  13. Fanelli, G. et al. “The interface of depression and diabetes: Treatment considerations.” Translational Psychiatry, vol. 15, no. 1, 2025, pp. 22. https://doi.org/10.1038/s41398-025-03234-5.
  14. Johnson, C. et al. “Sex, gender and other factors that influence infections for men and women.” Infectious Diseases in Clinical Practice, 2024. https://doi.org/10.1097/IPC.0000000000001405.
  15. Lang, J.C. et al. “Tissue-resident cells differentiate S. aureus from S. epidermidis via IL-1β following barrier disruption in healthy human skin.” PLOS Pathogens, vol. 20, no. 8, 2024, pp. e1012056. https://doi.org/10.1371/journal.ppat.1012056.
  16. Hatem, Z.A. et al. “Phenotypic and genotypic characterization of antibiotic resistance in Staphylococcus aureus isolated from different sources.” Jundishapur Journal of Microbiology, vol. 14, no. 4, 2021, pp. e115221. https://doi.org/10.5812/jjm.115221.
  17. Al-Hayali, R.T.G.H. “The phenotypic and genetic relationship of Staphylococcus aureus isolated from different infections and the inhibitory effect of antibiotics, nanoparticles and vitamin C.” College of Science, University of Mosul, Master's thesis, 2020. [In Arabic].
  18. Yassin, H.Y. et al. “Prevalence of exfoliative-toxin genes among clinical isolates of Staphylococcus aureus in Iraq.” Iraqi Journal of Agricultural Sciences, vol. 53, no. 2, 2022, pp. 465-470.
  19. Ahmed, R.Z.T. “Effect of Lactobacillus plantarum purification on some toxin genes of Staphylococcus aureus isolated from different clinical cases.” College of Education for Pure Sciences (Ibn Al-Haytham), University of Baghdad, PhD dissertation, 2024. [In Arabic].
  20. Alghamdi, B.A. et al. “Antimicrobial resistance in methicillin-resistant Staphylococcus aureus.” Saudi Journal of Biological Sciences, vol. 30, no. 4, 2023, pp. 103604.
  21. Al-Taey, Z.A.F. “Molecular typing of Staphylococcus aureus isolated from different clinical sources using the MLVA technique.” College of Science, University of Diyala, Master's thesis, 2021.
  22. Fitranda, M. et al. “Methicillin-resistant Staphylococcus aureus isolates derived from humans and animals in Yogyakarta, Indonesia.” Veterinary World, vol. 16, no. 1, 2023, pp. 239.
  23. Jabr, K.M. “Morphological and molecular investigation of some virulence factors of Staphylococcus aureus isolated from patients with atopic dermatitis and their antibiotic susceptibility.” College of Education for Pure Sciences, University of Diyala, Diploma thesis, 2023. [In Arabic].
  24. Ghari, M. et al. “Comparison of antibiotic resistance among biofilm-positive and -negative Staphylococcus aureus mastitis isolates.” Bulgarian Journal of Veterinary Medicine, vol. 27, no. 3, 2024.
  25. Zhang, H. et al. “Molecular characteristics and antibiotic resistance of Staphylococcus aureus isolated from patient and food samples in Shijiazhuang, China.” Pathogens, vol. 11, no. 11, 2022, pp. 1333.
  26. Mohammed, N.A. “Evaluation of spa gene expression and the antimicrobial effect of curcumin against Staphylococcus aureus isolated from atopic dermatitis patients.” College of Science, University of Baghdad, Master's thesis, 2023.
  27. Jasim, H.M. and Z.M. Alzubaidy. “Molecular detection of some virulence genes of methicillin-resistant Staphylococcus aureus clinical isolates in Diyala province.” Pakistan Journal of Medical and Health Sciences, vol. 16, no. 4, 2022, pp. 920.
  28. Aborah, E. et al. “Multidrug resistance and major facilitator superfamily antimicrobial efflux pumps of the ESKAPEE pathogen Staphylococcus aureus.” Exploration of Drug Science, vol. 3, 2025, pp. 100897.
  29. Hindi, A.K. et al. “Molecular study on distribution of sul-1 and sul-2 genes among Salmonella enterica causing enteric fever.” Al-Kufa University Journal for Biology, vol. 5, no. 2, 2013.
  30. Khan, S.B. et al. “Prevalence of antibiotic-resistant genes in Staphylococcus aureus isolated from bovine mastitis.” Pakistan Journal of Zoology, vol. 54, no. 5, 2022, pp. 2239.
  31. Rana, E.A. et al. “Frequently used therapeutic antimicrobials and their resistance patterns in Staphylococcus aureus and Escherichia coli from mastitis-affected lactating cows.” International Journal of Veterinary Science and Medicine, vol. 10, no. 1, 2022, pp. 1-10.
  32. Mshelia, M.B. et al. “Antibacterial resistance genes frequently detected in Nigeria.” African Journal Biomedical Research, vol. 27, no. 2, pp. 225-241. https://doi.org/10.4314/ajbr.v27i2.6.
  33. Shoaib, M. et al. “Molecular epidemiology and characterization of antimicrobial-resistant Staphylococcus haemolyticus strains isolated from dairy-cattle milk in Northwest China.” Frontiers in Cellular and Infection Microbiology, vol. 13, 2023, pp. 1183390.
  34. Brdová, D. et al. “Mechanism of staphylococcal resistance to clinically relevant antibiotics.” Drug Resistance Updates, vol. 77, 2024, pp. 101147. https://doi.org/10.1016/j.drup.2024.101147.
  35. Ferri, G. et al. “Antibiotic resistance profiles and ARG detection from isolated bacteria in a culture-dependent study at the codfish industry level.” Foods, vol. 12, no. 8, 2023, pp. 1699.
  36. Peng, J.J. et al. “Identification of antimicrobial resistance genes and drug-resistance analysis of Escherichia coli in the animal farm environment.” Journal of Infection and Public Health, vol. 14, no. 12, 2021, pp. 1788-1795.
Recommended Articles
Research Article

Assessment of Structural Integrity of Metal Staples in Used Toothbrushes: Wear and Deformation Analysis

...
Published: 05/08/2026
pdf Download PDF
Research Article

Molecular Detection of blaZ genes of Staphylococcus aureus Isolated from Urinary Tract Infection

...
Published: 05/08/2026
pdf Download PDF
Research Article

Microbial Contamination of Metal Staples in Used Toothbrushes: A Potential Oral Health Risk

...
Published: 05/08/2026
pdf Download PDF
Research Article

Current Utilization of X-ray in Orthopedic Emergency Cases in the Northern Border Region of Saudi Arabia

...
Published: 05/08/2026
pdf Download PDF
Copyright © Journal of Pioneering Medical Sciences until unless otherwise.